2505 lines
98 KiB
Plaintext
2505 lines
98 KiB
Plaintext
=head1 NAME
|
|
|
|
perlretut - Perl regular expressions tutorial
|
|
|
|
=head1 DESCRIPTION
|
|
|
|
This page provides a basic tutorial on understanding, creating and
|
|
using regular expressions in Perl. It serves as a complement to the
|
|
reference page on regular expressions L<perlre>. Regular expressions
|
|
are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
|
|
operators and so this tutorial also overlaps with
|
|
L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
|
|
|
|
Perl is widely renowned for excellence in text processing, and regular
|
|
expressions are one of the big factors behind this fame. Perl regular
|
|
expressions display an efficiency and flexibility unknown in most
|
|
other computer languages. Mastering even the basics of regular
|
|
expressions will allow you to manipulate text with surprising ease.
|
|
|
|
What is a regular expression? A regular expression is simply a string
|
|
that describes a pattern. Patterns are in common use these days;
|
|
examples are the patterns typed into a search engine to find web pages
|
|
and the patterns used to list files in a directory, e.g., C<ls *.txt>
|
|
or C<dir *.*>. In Perl, the patterns described by regular expressions
|
|
are used to search strings, extract desired parts of strings, and to
|
|
do search and replace operations.
|
|
|
|
Regular expressions have the undeserved reputation of being abstract
|
|
and difficult to understand. Regular expressions are constructed using
|
|
simple concepts like conditionals and loops and are no more difficult
|
|
to understand than the corresponding C<if> conditionals and C<while>
|
|
loops in the Perl language itself. In fact, the main challenge in
|
|
learning regular expressions is just getting used to the terse
|
|
notation used to express these concepts.
|
|
|
|
This tutorial flattens the learning curve by discussing regular
|
|
expression concepts, along with their notation, one at a time and with
|
|
many examples. The first part of the tutorial will progress from the
|
|
simplest word searches to the basic regular expression concepts. If
|
|
you master the first part, you will have all the tools needed to solve
|
|
about 98% of your needs. The second part of the tutorial is for those
|
|
comfortable with the basics and hungry for more power tools. It
|
|
discusses the more advanced regular expression operators and
|
|
introduces the latest cutting edge innovations in 5.6.0.
|
|
|
|
A note: to save time, 'regular expression' is often abbreviated as
|
|
regexp or regex. Regexp is a more natural abbreviation than regex, but
|
|
is harder to pronounce. The Perl pod documentation is evenly split on
|
|
regexp vs regex; in Perl, there is more than one way to abbreviate it.
|
|
We'll use regexp in this tutorial.
|
|
|
|
=head1 Part 1: The basics
|
|
|
|
=head2 Simple word matching
|
|
|
|
The simplest regexp is simply a word, or more generally, a string of
|
|
characters. A regexp consisting of a word matches any string that
|
|
contains that word:
|
|
|
|
"Hello World" =~ /World/; # matches
|
|
|
|
What is this perl statement all about? C<"Hello World"> is a simple
|
|
double quoted string. C<World> is the regular expression and the
|
|
C<//> enclosing C</World/> tells perl to search a string for a match.
|
|
The operator C<=~> associates the string with the regexp match and
|
|
produces a true value if the regexp matched, or false if the regexp
|
|
did not match. In our case, C<World> matches the second word in
|
|
C<"Hello World">, so the expression is true. Expressions like this
|
|
are useful in conditionals:
|
|
|
|
if ("Hello World" =~ /World/) {
|
|
print "It matches\n";
|
|
}
|
|
else {
|
|
print "It doesn't match\n";
|
|
}
|
|
|
|
There are useful variations on this theme. The sense of the match can
|
|
be reversed by using C<!~> operator:
|
|
|
|
if ("Hello World" !~ /World/) {
|
|
print "It doesn't match\n";
|
|
}
|
|
else {
|
|
print "It matches\n";
|
|
}
|
|
|
|
The literal string in the regexp can be replaced by a variable:
|
|
|
|
$greeting = "World";
|
|
if ("Hello World" =~ /$greeting/) {
|
|
print "It matches\n";
|
|
}
|
|
else {
|
|
print "It doesn't match\n";
|
|
}
|
|
|
|
If you're matching against the special default variable C<$_>, the
|
|
C<$_ =~> part can be omitted:
|
|
|
|
$_ = "Hello World";
|
|
if (/World/) {
|
|
print "It matches\n";
|
|
}
|
|
else {
|
|
print "It doesn't match\n";
|
|
}
|
|
|
|
And finally, the C<//> default delimiters for a match can be changed
|
|
to arbitrary delimiters by putting an C<'m'> out front:
|
|
|
|
"Hello World" =~ m!World!; # matches, delimited by '!'
|
|
"Hello World" =~ m{World}; # matches, note the matching '{}'
|
|
"/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
|
|
# '/' becomes an ordinary char
|
|
|
|
C</World/>, C<m!World!>, and C<m{World}> all represent the
|
|
same thing. When, e.g., C<""> is used as a delimiter, the forward
|
|
slash C<'/'> becomes an ordinary character and can be used in a regexp
|
|
without trouble.
|
|
|
|
Let's consider how different regexps would match C<"Hello World">:
|
|
|
|
"Hello World" =~ /world/; # doesn't match
|
|
"Hello World" =~ /o W/; # matches
|
|
"Hello World" =~ /oW/; # doesn't match
|
|
"Hello World" =~ /World /; # doesn't match
|
|
|
|
The first regexp C<world> doesn't match because regexps are
|
|
case-sensitive. The second regexp matches because the substring
|
|
S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
|
|
character ' ' is treated like any other character in a regexp and is
|
|
needed to match in this case. The lack of a space character is the
|
|
reason the third regexp C<'oW'> doesn't match. The fourth regexp
|
|
C<'World '> doesn't match because there is a space at the end of the
|
|
regexp, but not at the end of the string. The lesson here is that
|
|
regexps must match a part of the string I<exactly> in order for the
|
|
statement to be true.
|
|
|
|
If a regexp matches in more than one place in the string, perl will
|
|
always match at the earliest possible point in the string:
|
|
|
|
"Hello World" =~ /o/; # matches 'o' in 'Hello'
|
|
"That hat is red" =~ /hat/; # matches 'hat' in 'That'
|
|
|
|
With respect to character matching, there are a few more points you
|
|
need to know about. First of all, not all characters can be used 'as
|
|
is' in a match. Some characters, called B<metacharacters>, are reserved
|
|
for use in regexp notation. The metacharacters are
|
|
|
|
{}[]()^$.|*+?\
|
|
|
|
The significance of each of these will be explained
|
|
in the rest of the tutorial, but for now, it is important only to know
|
|
that a metacharacter can be matched by putting a backslash before it:
|
|
|
|
"2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
|
|
"2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
|
|
"The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
|
|
"The interval is [0,1)." =~ /\[0,1\)\./ # matches
|
|
"/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
|
|
|
|
In the last regexp, the forward slash C<'/'> is also backslashed,
|
|
because it is used to delimit the regexp. This can lead to LTS
|
|
(leaning toothpick syndrome), however, and it is often more readable
|
|
to change delimiters.
|
|
|
|
|
|
The backslash character C<'\'> is a metacharacter itself and needs to
|
|
be backslashed:
|
|
|
|
'C:\WIN32' =~ /C:\\WIN/; # matches
|
|
|
|
In addition to the metacharacters, there are some ASCII characters
|
|
which don't have printable character equivalents and are instead
|
|
represented by B<escape sequences>. Common examples are C<\t> for a
|
|
tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
|
|
bell. If your string is better thought of as a sequence of arbitrary
|
|
bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
|
|
sequence, e.g., C<\x1B> may be a more natural representation for your
|
|
bytes. Here are some examples of escapes:
|
|
|
|
"1000\t2000" =~ m(0\t2) # matches
|
|
"1000\n2000" =~ /0\n20/ # matches
|
|
"1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
|
|
"cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
|
|
|
|
If you've been around Perl a while, all this talk of escape sequences
|
|
may seem familiar. Similar escape sequences are used in double-quoted
|
|
strings and in fact the regexps in Perl are mostly treated as
|
|
double-quoted strings. This means that variables can be used in
|
|
regexps as well. Just like double-quoted strings, the values of the
|
|
variables in the regexp will be substituted in before the regexp is
|
|
evaluated for matching purposes. So we have:
|
|
|
|
$foo = 'house';
|
|
'housecat' =~ /$foo/; # matches
|
|
'cathouse' =~ /cat$foo/; # matches
|
|
'housecat' =~ /${foo}cat/; # matches
|
|
|
|
So far, so good. With the knowledge above you can already perform
|
|
searches with just about any literal string regexp you can dream up.
|
|
Here is a I<very simple> emulation of the Unix grep program:
|
|
|
|
% cat > simple_grep
|
|
#!/usr/bin/perl
|
|
$regexp = shift;
|
|
while (<>) {
|
|
print if /$regexp/;
|
|
}
|
|
^D
|
|
|
|
% chmod +x simple_grep
|
|
|
|
% simple_grep abba /usr/dict/words
|
|
Babbage
|
|
cabbage
|
|
cabbages
|
|
sabbath
|
|
Sabbathize
|
|
Sabbathizes
|
|
sabbatical
|
|
scabbard
|
|
scabbards
|
|
|
|
This program is easy to understand. C<#!/usr/bin/perl> is the standard
|
|
way to invoke a perl program from the shell.
|
|
S<C<$regexp = shift;> > saves the first command line argument as the
|
|
regexp to be used, leaving the rest of the command line arguments to
|
|
be treated as files. S<C<< while (<>) >> > loops over all the lines in
|
|
all the files. For each line, S<C<print if /$regexp/;> > prints the
|
|
line if the regexp matches the line. In this line, both C<print> and
|
|
C</$regexp/> use the default variable C<$_> implicitly.
|
|
|
|
With all of the regexps above, if the regexp matched anywhere in the
|
|
string, it was considered a match. Sometimes, however, we'd like to
|
|
specify I<where> in the string the regexp should try to match. To do
|
|
this, we would use the B<anchor> metacharacters C<^> and C<$>. The
|
|
anchor C<^> means match at the beginning of the string and the anchor
|
|
C<$> means match at the end of the string, or before a newline at the
|
|
end of the string. Here is how they are used:
|
|
|
|
"housekeeper" =~ /keeper/; # matches
|
|
"housekeeper" =~ /^keeper/; # doesn't match
|
|
"housekeeper" =~ /keeper$/; # matches
|
|
"housekeeper\n" =~ /keeper$/; # matches
|
|
|
|
The second regexp doesn't match because C<^> constrains C<keeper> to
|
|
match only at the beginning of the string, but C<"housekeeper"> has
|
|
keeper starting in the middle. The third regexp does match, since the
|
|
C<$> constrains C<keeper> to match only at the end of the string.
|
|
|
|
When both C<^> and C<$> are used at the same time, the regexp has to
|
|
match both the beginning and the end of the string, i.e., the regexp
|
|
matches the whole string. Consider
|
|
|
|
"keeper" =~ /^keep$/; # doesn't match
|
|
"keeper" =~ /^keeper$/; # matches
|
|
"" =~ /^$/; # ^$ matches an empty string
|
|
|
|
The first regexp doesn't match because the string has more to it than
|
|
C<keep>. Since the second regexp is exactly the string, it
|
|
matches. Using both C<^> and C<$> in a regexp forces the complete
|
|
string to match, so it gives you complete control over which strings
|
|
match and which don't. Suppose you are looking for a fellow named
|
|
bert, off in a string by himself:
|
|
|
|
"dogbert" =~ /bert/; # matches, but not what you want
|
|
|
|
"dilbert" =~ /^bert/; # doesn't match, but ..
|
|
"bertram" =~ /^bert/; # matches, so still not good enough
|
|
|
|
"bertram" =~ /^bert$/; # doesn't match, good
|
|
"dilbert" =~ /^bert$/; # doesn't match, good
|
|
"bert" =~ /^bert$/; # matches, perfect
|
|
|
|
Of course, in the case of a literal string, one could just as easily
|
|
use the string equivalence S<C<$string eq 'bert'> > and it would be
|
|
more efficient. The C<^...$> regexp really becomes useful when we
|
|
add in the more powerful regexp tools below.
|
|
|
|
=head2 Using character classes
|
|
|
|
Although one can already do quite a lot with the literal string
|
|
regexps above, we've only scratched the surface of regular expression
|
|
technology. In this and subsequent sections we will introduce regexp
|
|
concepts (and associated metacharacter notations) that will allow a
|
|
regexp to not just represent a single character sequence, but a I<whole
|
|
class> of them.
|
|
|
|
One such concept is that of a B<character class>. A character class
|
|
allows a set of possible characters, rather than just a single
|
|
character, to match at a particular point in a regexp. Character
|
|
classes are denoted by brackets C<[...]>, with the set of characters
|
|
to be possibly matched inside. Here are some examples:
|
|
|
|
/cat/; # matches 'cat'
|
|
/[bcr]at/; # matches 'bat, 'cat', or 'rat'
|
|
/item[0123456789]/; # matches 'item0' or ... or 'item9'
|
|
"abc" =~ /[cab]/; # matches 'a'
|
|
|
|
In the last statement, even though C<'c'> is the first character in
|
|
the class, C<'a'> matches because the first character position in the
|
|
string is the earliest point at which the regexp can match.
|
|
|
|
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
|
|
# 'yes', 'Yes', 'YES', etc.
|
|
|
|
This regexp displays a common task: perform a a case-insensitive
|
|
match. Perl provides away of avoiding all those brackets by simply
|
|
appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
|
|
can be rewritten as C</yes/i;>. The C<'i'> stands for
|
|
case-insensitive and is an example of a B<modifier> of the matching
|
|
operation. We will meet other modifiers later in the tutorial.
|
|
|
|
We saw in the section above that there were ordinary characters, which
|
|
represented themselves, and special characters, which needed a
|
|
backslash C<\> to represent themselves. The same is true in a
|
|
character class, but the sets of ordinary and special characters
|
|
inside a character class are different than those outside a character
|
|
class. The special characters for a character class are C<-]\^$>. C<]>
|
|
is special because it denotes the end of a character class. C<$> is
|
|
special because it denotes a scalar variable. C<\> is special because
|
|
it is used in escape sequences, just like above. Here is how the
|
|
special characters C<]$\> are handled:
|
|
|
|
/[\]c]def/; # matches ']def' or 'cdef'
|
|
$x = 'bcr';
|
|
/[$x]at/; # matches 'bat', 'cat', or 'rat'
|
|
/[\$x]at/; # matches '$at' or 'xat'
|
|
/[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
|
|
|
|
The last two are a little tricky. in C<[\$x]>, the backslash protects
|
|
the dollar sign, so the character class has two members C<$> and C<x>.
|
|
In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
|
|
variable and substituted in double quote fashion.
|
|
|
|
The special character C<'-'> acts as a range operator within character
|
|
classes, so that a contiguous set of characters can be written as a
|
|
range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
|
|
become the svelte C<[0-9]> and C<[a-z]>. Some examples are
|
|
|
|
/item[0-9]/; # matches 'item0' or ... or 'item9'
|
|
/[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
|
|
# 'baa', 'xaa', 'yaa', or 'zaa'
|
|
/[0-9a-fA-F]/; # matches a hexadecimal digit
|
|
/[0-9a-zA-Z_]/; # matches a "word" character,
|
|
# like those in a perl variable name
|
|
|
|
If C<'-'> is the first or last character in a character class, it is
|
|
treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
|
|
all equivalent.
|
|
|
|
The special character C<^> in the first position of a character class
|
|
denotes a B<negated character class>, which matches any character but
|
|
those in the brackets. Both C<[...]> and C<[^...]> must match a
|
|
character, or the match fails. Then
|
|
|
|
/[^a]at/; # doesn't match 'aat' or 'at', but matches
|
|
# all other 'bat', 'cat, '0at', '%at', etc.
|
|
/[^0-9]/; # matches a non-numeric character
|
|
/[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
|
|
|
|
Now, even C<[0-9]> can be a bother the write multiple times, so in the
|
|
interest of saving keystrokes and making regexps more readable, Perl
|
|
has several abbreviations for common character classes:
|
|
|
|
=over 4
|
|
|
|
=item *
|
|
|
|
\d is a digit and represents [0-9]
|
|
|
|
=item *
|
|
|
|
\s is a whitespace character and represents [\ \t\r\n\f]
|
|
|
|
=item *
|
|
|
|
\w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
|
|
|
|
=item *
|
|
|
|
\D is a negated \d; it represents any character but a digit [^0-9]
|
|
|
|
=item *
|
|
|
|
\S is a negated \s; it represents any non-whitespace character [^\s]
|
|
|
|
=item *
|
|
|
|
\W is a negated \w; it represents any non-word character [^\w]
|
|
|
|
=item *
|
|
|
|
The period '.' matches any character but "\n"
|
|
|
|
=back
|
|
|
|
The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
|
|
of character classes. Here are some in use:
|
|
|
|
/\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
|
|
/[\d\s]/; # matches any digit or whitespace character
|
|
/\w\W\w/; # matches a word char, followed by a
|
|
# non-word char, followed by a word char
|
|
/..rt/; # matches any two chars, followed by 'rt'
|
|
/end\./; # matches 'end.'
|
|
/end[.]/; # same thing, matches 'end.'
|
|
|
|
Because a period is a metacharacter, it needs to be escaped to match
|
|
as an ordinary period. Because, for example, C<\d> and C<\w> are sets
|
|
of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
|
|
fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
|
|
C<[\W]>. Think DeMorgan's laws.
|
|
|
|
An anchor useful in basic regexps is the S<B<word anchor> >
|
|
C<\b>. This matches a boundary between a word character and a non-word
|
|
character C<\w\W> or C<\W\w>:
|
|
|
|
$x = "Housecat catenates house and cat";
|
|
$x =~ /cat/; # matches cat in 'housecat'
|
|
$x =~ /\bcat/; # matches cat in 'catenates'
|
|
$x =~ /cat\b/; # matches cat in 'housecat'
|
|
$x =~ /\bcat\b/; # matches 'cat' at end of string
|
|
|
|
Note in the last example, the end of the string is considered a word
|
|
boundary.
|
|
|
|
You might wonder why C<'.'> matches everything but C<"\n"> - why not
|
|
every character? The reason is that often one is matching against
|
|
lines and would like to ignore the newline characters. For instance,
|
|
while the string C<"\n"> represents one line, we would like to think
|
|
of as empty. Then
|
|
|
|
"" =~ /^$/; # matches
|
|
"\n" =~ /^$/; # matches, "\n" is ignored
|
|
|
|
"" =~ /./; # doesn't match; it needs a char
|
|
"" =~ /^.$/; # doesn't match; it needs a char
|
|
"\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
|
|
"a" =~ /^.$/; # matches
|
|
"a\n" =~ /^.$/; # matches, ignores the "\n"
|
|
|
|
This behavior is convenient, because we usually want to ignore
|
|
newlines when we count and match characters in a line. Sometimes,
|
|
however, we want to keep track of newlines. We might even want C<^>
|
|
and C<$> to anchor at the beginning and end of lines within the
|
|
string, rather than just the beginning and end of the string. Perl
|
|
allows us to choose between ignoring and paying attention to newlines
|
|
by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
|
|
single line and multi-line and they determine whether a string is to
|
|
be treated as one continuous string, or as a set of lines. The two
|
|
modifiers affect two aspects of how the regexp is interpreted: 1) how
|
|
the C<'.'> character class is defined, and 2) where the anchors C<^>
|
|
and C<$> are able to match. Here are the four possible combinations:
|
|
|
|
=over 4
|
|
|
|
=item *
|
|
|
|
no modifiers (//): Default behavior. C<'.'> matches any character
|
|
except C<"\n">. C<^> matches only at the beginning of the string and
|
|
C<$> matches only at the end or before a newline at the end.
|
|
|
|
=item *
|
|
|
|
s modifier (//s): Treat string as a single long line. C<'.'> matches
|
|
any character, even C<"\n">. C<^> matches only at the beginning of
|
|
the string and C<$> matches only at the end or before a newline at the
|
|
end.
|
|
|
|
=item *
|
|
|
|
m modifier (//m): Treat string as a set of multiple lines. C<'.'>
|
|
matches any character except C<"\n">. C<^> and C<$> are able to match
|
|
at the start or end of I<any> line within the string.
|
|
|
|
=item *
|
|
|
|
both s and m modifiers (//sm): Treat string as a single long line, but
|
|
detect multiple lines. C<'.'> matches any character, even
|
|
C<"\n">. C<^> and C<$>, however, are able to match at the start or end
|
|
of I<any> line within the string.
|
|
|
|
=back
|
|
|
|
Here are examples of C<//s> and C<//m> in action:
|
|
|
|
$x = "There once was a girl\nWho programmed in Perl\n";
|
|
|
|
$x =~ /^Who/; # doesn't match, "Who" not at start of string
|
|
$x =~ /^Who/s; # doesn't match, "Who" not at start of string
|
|
$x =~ /^Who/m; # matches, "Who" at start of second line
|
|
$x =~ /^Who/sm; # matches, "Who" at start of second line
|
|
|
|
$x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
|
|
$x =~ /girl.Who/s; # matches, "." matches "\n"
|
|
$x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
|
|
$x =~ /girl.Who/sm; # matches, "." matches "\n"
|
|
|
|
Most of the time, the default behavior is what is want, but C<//s> and
|
|
C<//m> are occasionally very useful. If C<//m> is being used, the start
|
|
of the string can still be matched with C<\A> and the end of string
|
|
can still be matched with the anchors C<\Z> (matches both the end and
|
|
the newline before, like C<$>), and C<\z> (matches only the end):
|
|
|
|
$x =~ /^Who/m; # matches, "Who" at start of second line
|
|
$x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
|
|
|
|
$x =~ /girl$/m; # matches, "girl" at end of first line
|
|
$x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
|
|
|
|
$x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
|
|
$x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
|
|
|
|
We now know how to create choices among classes of characters in a
|
|
regexp. What about choices among words or character strings? Such
|
|
choices are described in the next section.
|
|
|
|
=head2 Matching this or that
|
|
|
|
Sometimes we would like to our regexp to be able to match different
|
|
possible words or character strings. This is accomplished by using
|
|
the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
|
|
form the regexp C<dog|cat>. As before, perl will try to match the
|
|
regexp at the earliest possible point in the string. At each
|
|
character position, perl will first try to match the first
|
|
alternative, C<dog>. If C<dog> doesn't match, perl will then try the
|
|
next alternative, C<cat>. If C<cat> doesn't match either, then the
|
|
match fails and perl moves to the next position in the string. Some
|
|
examples:
|
|
|
|
"cats and dogs" =~ /cat|dog|bird/; # matches "cat"
|
|
"cats and dogs" =~ /dog|cat|bird/; # matches "cat"
|
|
|
|
Even though C<dog> is the first alternative in the second regexp,
|
|
C<cat> is able to match earlier in the string.
|
|
|
|
"cats" =~ /c|ca|cat|cats/; # matches "c"
|
|
"cats" =~ /cats|cat|ca|c/; # matches "cats"
|
|
|
|
Here, all the alternatives match at the first string position, so the
|
|
first alternative is the one that matches. If some of the
|
|
alternatives are truncations of the others, put the longest ones first
|
|
to give them a chance to match.
|
|
|
|
"cab" =~ /a|b|c/ # matches "c"
|
|
# /a|b|c/ == /[abc]/
|
|
|
|
The last example points out that character classes are like
|
|
alternations of characters. At a given character position, the first
|
|
alternative that allows the regexp match to succeed wil be the one
|
|
that matches.
|
|
|
|
=head2 Grouping things and hierarchical matching
|
|
|
|
Alternation allows a regexp to choose among alternatives, but by
|
|
itself it unsatisfying. The reason is that each alternative is a whole
|
|
regexp, but sometime we want alternatives for just part of a
|
|
regexp. For instance, suppose we want to search for housecats or
|
|
housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
|
|
inefficient because we had to type C<house> twice. It would be nice to
|
|
have parts of the regexp be constant, like C<house>, and and some
|
|
parts have alternatives, like C<cat|keeper>.
|
|
|
|
The B<grouping> metacharacters C<()> solve this problem. Grouping
|
|
allows parts of a regexp to be treated as a single unit. Parts of a
|
|
regexp are grouped by enclosing them in parentheses. Thus we could solve
|
|
the C<housecat|housekeeper> by forming the regexp as
|
|
C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
|
|
C<house> followed by either C<cat> or C<keeper>. Some more examples
|
|
are
|
|
|
|
/(a|b)b/; # matches 'ab' or 'bb'
|
|
/(ac|b)b/; # matches 'acb' or 'bb'
|
|
/(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
|
|
/(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
|
|
|
|
/house(cat|)/; # matches either 'housecat' or 'house'
|
|
/house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
|
|
# 'house'. Note groups can be nested.
|
|
|
|
/(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
|
|
"20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
|
|
# because '20\d\d' can't match
|
|
|
|
Alternations behave the same way in groups as out of them: at a given
|
|
string position, the leftmost alternative that allows the regexp to
|
|
match is taken. So in the last example at tth first string position,
|
|
C<"20"> matches the second alternative, but there is nothing left over
|
|
to match the next two digits C<\d\d>. So perl moves on to the next
|
|
alternative, which is the null alternative and that works, since
|
|
C<"20"> is two digits.
|
|
|
|
The process of trying one alternative, seeing if it matches, and
|
|
moving on to the next alternative if it doesn't, is called
|
|
B<backtracking>. The term 'backtracking' comes from the idea that
|
|
matching a regexp is like a walk in the woods. Successfully matching
|
|
a regexp is like arriving at a destination. There are many possible
|
|
trailheads, one for each string position, and each one is tried in
|
|
order, left to right. From each trailhead there may be many paths,
|
|
some of which get you there, and some which are dead ends. When you
|
|
walk along a trail and hit a dead end, you have to backtrack along the
|
|
trail to an earlier point to try another trail. If you hit your
|
|
destination, you stop immediately and forget about trying all the
|
|
other trails. You are persistent, and only if you have tried all the
|
|
trails from all the trailheads and not arrived at your destination, do
|
|
you declare failure. To be concrete, here is a step-by-step analysis
|
|
of what perl does when it tries to match the regexp
|
|
|
|
"abcde" =~ /(abd|abc)(df|d|de)/;
|
|
|
|
=over 4
|
|
|
|
=item 0
|
|
|
|
Start with the first letter in the string 'a'.
|
|
|
|
=item 1
|
|
|
|
Try the first alternative in the first group 'abd'.
|
|
|
|
=item 2
|
|
|
|
Match 'a' followed by 'b'. So far so good.
|
|
|
|
=item 3
|
|
|
|
'd' in the regexp doesn't match 'c' in the string - a dead
|
|
end. So backtrack two characters and pick the second alternative in
|
|
the first group 'abc'.
|
|
|
|
=item 4
|
|
|
|
Match 'a' followed by 'b' followed by 'c'. We are on a roll
|
|
and have satisfied the first group. Set $1 to 'abc'.
|
|
|
|
=item 5
|
|
|
|
Move on to the second group and pick the first alternative
|
|
'df'.
|
|
|
|
=item 6
|
|
|
|
Match the 'd'.
|
|
|
|
=item 7
|
|
|
|
'f' in the regexp doesn't match 'e' in the string, so a dead
|
|
end. Backtrack one character and pick the second alternative in the
|
|
second group 'd'.
|
|
|
|
=item 8
|
|
|
|
'd' matches. The second grouping is satisfied, so set $2 to
|
|
'd'.
|
|
|
|
=item 9
|
|
|
|
We are at the end of the regexp, so we are done! We have
|
|
matched 'abcd' out of the string "abcde".
|
|
|
|
=back
|
|
|
|
There are a couple of things to note about this analysis. First, the
|
|
third alternative in the second group 'de' also allows a match, but we
|
|
stopped before we got to it - at a given character position, leftmost
|
|
wins. Second, we were able to get a match at the first character
|
|
position of the string 'a'. If there were no matches at the first
|
|
position, perl would move to the second character position 'b' and
|
|
attempt the match all over again. Only when all possible paths at all
|
|
possible character positions have been exhausted does perl give give
|
|
up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
|
|
|
|
Even with all this work, regexp matching happens remarkably fast. To
|
|
speed things up, during compilation stage, perl compiles the regexp
|
|
into a compact sequence of opcodes that can often fit inside a
|
|
processor cache. When the code is executed, these opcodes can then run
|
|
at full throttle and search very quickly.
|
|
|
|
=head2 Extracting matches
|
|
|
|
The grouping metacharacters C<()> also serve another completely
|
|
different function: they allow the extraction of the parts of a string
|
|
that matched. This is very useful to find out what matched and for
|
|
text processing in general. For each grouping, the part that matched
|
|
inside goes into the special variables C<$1>, C<$2>, etc. They can be
|
|
used just as ordinary variables:
|
|
|
|
# extract hours, minutes, seconds
|
|
$time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
|
|
$hours = $1;
|
|
$minutes = $2;
|
|
$seconds = $3;
|
|
|
|
Now, we know that in scalar context,
|
|
S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
|
|
value. In list context, however, it returns the list of matched values
|
|
C<($1,$2,$3)>. So we could write the code more compactly as
|
|
|
|
# extract hours, minutes, seconds
|
|
($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
|
|
|
|
If the groupings in a regexp are nested, C<$1> gets the group with the
|
|
leftmost opening parenthesis, C<$2> the next opening parenthesis,
|
|
etc. For example, here is a complex regexp and the matching variables
|
|
indicated below it:
|
|
|
|
/(ab(cd|ef)((gi)|j))/;
|
|
1 2 34
|
|
|
|
so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'.
|
|
For convenience, perl sets C<$+> to the highest numbered C<$1>, C<$2>,
|
|
... that got assigned.
|
|
|
|
Closely associated with the matching variables C<$1>, C<$2>, ... are
|
|
the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
|
|
matching variables that can be used I<inside> a regexp. This is a
|
|
really nice feature - what matches later in a regexp can depend on
|
|
what matched earlier in the regexp. Suppose we wanted to look
|
|
for doubled words in text, like 'the the'. The following regexp finds
|
|
all 3-letter doubles with a space in between:
|
|
|
|
/(\w\w\w)\s\1/;
|
|
|
|
The grouping assigns a value to \1, so that the same 3 letter sequence
|
|
is used for both parts. Here are some words with repeated parts:
|
|
|
|
% simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
|
|
beriberi
|
|
booboo
|
|
coco
|
|
mama
|
|
murmur
|
|
papa
|
|
|
|
The regexp has a single grouping which considers 4-letter
|
|
combinations, then 3-letter combinations, etc. and uses C<\1> to look for
|
|
a repeat. Although C<$1> and C<\1> represent the same thing, care should be
|
|
taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
|
|
and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
|
|
so may lead to surprising and/or undefined results.
|
|
|
|
In addition to what was matched, Perl 5.6.0 also provides the
|
|
positions of what was matched with the C<@-> and C<@+>
|
|
arrays. C<$-[0]> is the position of the start of the entire match and
|
|
C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
|
|
position of the start of the C<$n> match and C<$+[n]> is the position
|
|
of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
|
|
this code
|
|
|
|
$x = "Mmm...donut, thought Homer";
|
|
$x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
|
|
foreach $expr (1..$#-) {
|
|
print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
|
|
}
|
|
|
|
prints
|
|
|
|
Match 1: 'Mmm' at position (0,3)
|
|
Match 2: 'donut' at position (6,11)
|
|
|
|
Even if there are no groupings in a regexp, it is still possible to
|
|
find out what exactly matched in a string. If you use them, perl
|
|
will set C<$`> to the part of the string before the match, will set C<$&>
|
|
to the part of the string that matched, and will set C<$'> to the part
|
|
of the string after the match. An example:
|
|
|
|
$x = "the cat caught the mouse";
|
|
$x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
|
|
$x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
|
|
|
|
In the second match, S<C<$` = ''> > because the regexp matched at the
|
|
first character position in the string and stopped, it never saw the
|
|
second 'the'. It is important to note that using C<$`> and C<$'>
|
|
slows down regexp matching quite a bit, and C< $& > slows it down to a
|
|
lesser extent, because if they are used in one regexp in a program,
|
|
they are generated for <all> regexps in the program. So if raw
|
|
performance is a goal of your application, they should be avoided.
|
|
If you need them, use C<@-> and C<@+> instead:
|
|
|
|
$` is the same as substr( $x, 0, $-[0] )
|
|
$& is the same as substr( $x, $-[0], $+[0]-$-[0] )
|
|
$' is the same as substr( $x, $+[0] )
|
|
|
|
=head2 Matching repetitions
|
|
|
|
The examples in the previous section display an annoying weakness. We
|
|
were only matching 3-letter words, or syllables of 4 letters or
|
|
less. We'd like to be able to match words or syllables of any length,
|
|
without writing out tedious alternatives like
|
|
C<\w\w\w\w|\w\w\w|\w\w|\w>.
|
|
|
|
This is exactly the problem the B<quantifier> metacharacters C<?>,
|
|
C<*>, C<+>, and C<{}> were created for. They allow us to determine the
|
|
number of repeats of a portion of a regexp we consider to be a
|
|
match. Quantifiers are put immediately after the character, character
|
|
class, or grouping that we want to specify. They have the following
|
|
meanings:
|
|
|
|
=over 4
|
|
|
|
=item *
|
|
|
|
C<a?> = match 'a' 1 or 0 times
|
|
|
|
=item *
|
|
|
|
C<a*> = match 'a' 0 or more times, i.e., any number of times
|
|
|
|
=item *
|
|
|
|
C<a+> = match 'a' 1 or more times, i.e., at least once
|
|
|
|
=item *
|
|
|
|
C<a{n,m}> = match at least C<n> times, but not more than C<m>
|
|
times.
|
|
|
|
=item *
|
|
|
|
C<a{n,}> = match at least C<n> or more times
|
|
|
|
=item *
|
|
|
|
C<a{n}> = match exactly C<n> times
|
|
|
|
=back
|
|
|
|
Here are some examples:
|
|
|
|
/[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
|
|
# any number of digits
|
|
/(\w+)\s+\1/; # match doubled words of arbitrary length
|
|
/y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
|
|
$year =~ /\d{2,4}/; # make sure year is at least 2 but not more
|
|
# than 4 digits
|
|
$year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
|
|
$year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
|
|
# this produces $1 and the other does not.
|
|
|
|
% simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
|
|
beriberi
|
|
booboo
|
|
coco
|
|
mama
|
|
murmur
|
|
papa
|
|
|
|
For all of these quantifiers, perl will try to match as much of the
|
|
string as possible, while still allowing the regexp to succeed. Thus
|
|
with C</a?.../>, perl will first try to match the regexp with the C<a>
|
|
present; if that fails, perl will try to match the regexp without the
|
|
C<a> present. For the quantifier C<*>, we get the following:
|
|
|
|
$x = "the cat in the hat";
|
|
$x =~ /^(.*)(cat)(.*)$/; # matches,
|
|
# $1 = 'the '
|
|
# $2 = 'cat'
|
|
# $3 = ' in the hat'
|
|
|
|
Which is what we might expect, the match finds the only C<cat> in the
|
|
string and locks onto it. Consider, however, this regexp:
|
|
|
|
$x =~ /^(.*)(at)(.*)$/; # matches,
|
|
# $1 = 'the cat in the h'
|
|
# $2 = 'at'
|
|
# $3 = '' (0 matches)
|
|
|
|
One might initially guess that perl would find the C<at> in C<cat> and
|
|
stop there, but that wouldn't give the longest possible string to the
|
|
first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
|
|
much of the string as possible while still having the regexp match. In
|
|
this example, that means having the C<at> sequence with the final C<at>
|
|
in the string. The other important principle illustrated here is that
|
|
when there are two or more elements in a regexp, the I<leftmost>
|
|
quantifier, if there is one, gets to grab as much the string as
|
|
possible, leaving the rest of the regexp to fight over scraps. Thus in
|
|
our example, the first quantifier C<.*> grabs most of the string, while
|
|
the second quantifier C<.*> gets the empty string. Quantifiers that
|
|
grab as much of the string as possible are called B<maximal match> or
|
|
B<greedy> quantifiers.
|
|
|
|
When a regexp can match a string in several different ways, we can use
|
|
the principles above to predict which way the regexp will match:
|
|
|
|
=over 4
|
|
|
|
=item *
|
|
|
|
Principle 0: Taken as a whole, any regexp will be matched at the
|
|
earliest possible position in the string.
|
|
|
|
=item *
|
|
|
|
Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
|
|
that allows a match for the whole regexp will be the one used.
|
|
|
|
=item *
|
|
|
|
Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
|
|
C<{n,m}> will in general match as much of the string as possible while
|
|
still allowing the whole regexp to match.
|
|
|
|
=item *
|
|
|
|
Principle 3: If there are two or more elements in a regexp, the
|
|
leftmost greedy quantifier, if any, will match as much of the string
|
|
as possible while still allowing the whole regexp to match. The next
|
|
leftmost greedy quantifier, if any, will try to match as much of the
|
|
string remaining available to it as possible, while still allowing the
|
|
whole regexp to match. And so on, until all the regexp elements are
|
|
satisfied.
|
|
|
|
=back
|
|
|
|
As we have seen above, Principle 0 overrides the others - the regexp
|
|
will be matched as early as possible, with the other principles
|
|
determining how the regexp matches at that earliest character
|
|
position.
|
|
|
|
Here is an example of these principles in action:
|
|
|
|
$x = "The programming republic of Perl";
|
|
$x =~ /^(.+)(e|r)(.*)$/; # matches,
|
|
# $1 = 'The programming republic of Pe'
|
|
# $2 = 'r'
|
|
# $3 = 'l'
|
|
|
|
This regexp matches at the earliest string position, C<'T'>. One
|
|
might think that C<e>, being leftmost in the alternation, would be
|
|
matched, but C<r> produces the longest string in the first quantifier.
|
|
|
|
$x =~ /(m{1,2})(.*)$/; # matches,
|
|
# $1 = 'mm'
|
|
# $2 = 'ing republic of Perl'
|
|
|
|
Here, The earliest possible match is at the first C<'m'> in
|
|
C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
|
|
a maximal C<mm>.
|
|
|
|
$x =~ /.*(m{1,2})(.*)$/; # matches,
|
|
# $1 = 'm'
|
|
# $2 = 'ing republic of Perl'
|
|
|
|
Here, the regexp matches at the start of the string. The first
|
|
quantifier C<.*> grabs as much as possible, leaving just a single
|
|
C<'m'> for the second quantifier C<m{1,2}>.
|
|
|
|
$x =~ /(.?)(m{1,2})(.*)$/; # matches,
|
|
# $1 = 'a'
|
|
# $2 = 'mm'
|
|
# $3 = 'ing republic of Perl'
|
|
|
|
Here, C<.?> eats its maximal one character at the earliest possible
|
|
position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
|
|
the opportunity to match both C<m>'s. Finally,
|
|
|
|
"aXXXb" =~ /(X*)/; # matches with $1 = ''
|
|
|
|
because it can match zero copies of C<'X'> at the beginning of the
|
|
string. If you definitely want to match at least one C<'X'>, use
|
|
C<X+>, not C<X*>.
|
|
|
|
Sometimes greed is not good. At times, we would like quantifiers to
|
|
match a I<minimal> piece of string, rather than a maximal piece. For
|
|
this purpose, Larry Wall created the S<B<minimal match> > or
|
|
B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
|
|
the usual quantifiers with a C<?> appended to them. They have the
|
|
following meanings:
|
|
|
|
=over 4
|
|
|
|
=item *
|
|
|
|
C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
|
|
|
|
=item *
|
|
|
|
C<a*?> = match 'a' 0 or more times, i.e., any number of times,
|
|
but as few times as possible
|
|
|
|
=item *
|
|
|
|
C<a+?> = match 'a' 1 or more times, i.e., at least once, but
|
|
as few times as possible
|
|
|
|
=item *
|
|
|
|
C<a{n,m}?> = match at least C<n> times, not more than C<m>
|
|
times, as few times as possible
|
|
|
|
=item *
|
|
|
|
C<a{n,}?> = match at least C<n> times, but as few times as
|
|
possible
|
|
|
|
=item *
|
|
|
|
C<a{n}?> = match exactly C<n> times. Because we match exactly
|
|
C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
|
|
notational consistency.
|
|
|
|
=back
|
|
|
|
Let's look at the example above, but with minimal quantifiers:
|
|
|
|
$x = "The programming republic of Perl";
|
|
$x =~ /^(.+?)(e|r)(.*)$/; # matches,
|
|
# $1 = 'Th'
|
|
# $2 = 'e'
|
|
# $3 = ' programming republic of Perl'
|
|
|
|
The minimal string that will allow both the start of the string C<^>
|
|
and the alternation to match is C<Th>, with the alternation C<e|r>
|
|
matching C<e>. The second quantifier C<.*> is free to gobble up the
|
|
rest of the string.
|
|
|
|
$x =~ /(m{1,2}?)(.*?)$/; # matches,
|
|
# $1 = 'm'
|
|
# $2 = 'ming republic of Perl'
|
|
|
|
The first string position that this regexp can match is at the first
|
|
C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
|
|
matches just one C<'m'>. Although the second quantifier C<.*?> would
|
|
prefer to match no characters, it is constrained by the end-of-string
|
|
anchor C<$> to match the rest of the string.
|
|
|
|
$x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
|
|
# $1 = 'The progra'
|
|
# $2 = 'm'
|
|
# $3 = 'ming republic of Perl'
|
|
|
|
In this regexp, you might expect the first minimal quantifier C<.*?>
|
|
to match the empty string, because it is not constrained by a C<^>
|
|
anchor to match the beginning of the word. Principle 0 applies here,
|
|
however. Because it is possible for the whole regexp to match at the
|
|
start of the string, it I<will> match at the start of the string. Thus
|
|
the first quantifier has to match everything up to the first C<m>. The
|
|
second minimal quantifier matches just one C<m> and the third
|
|
quantifier matches the rest of the string.
|
|
|
|
$x =~ /(.??)(m{1,2})(.*)$/; # matches,
|
|
# $1 = 'a'
|
|
# $2 = 'mm'
|
|
# $3 = 'ing republic of Perl'
|
|
|
|
Just as in the previous regexp, the first quantifier C<.??> can match
|
|
earliest at position C<'a'>, so it does. The second quantifier is
|
|
greedy, so it matches C<mm>, and the third matches the rest of the
|
|
string.
|
|
|
|
We can modify principle 3 above to take into account non-greedy
|
|
quantifiers:
|
|
|
|
=over 4
|
|
|
|
=item *
|
|
|
|
Principle 3: If there are two or more elements in a regexp, the
|
|
leftmost greedy (non-greedy) quantifier, if any, will match as much
|
|
(little) of the string as possible while still allowing the whole
|
|
regexp to match. The next leftmost greedy (non-greedy) quantifier, if
|
|
any, will try to match as much (little) of the string remaining
|
|
available to it as possible, while still allowing the whole regexp to
|
|
match. And so on, until all the regexp elements are satisfied.
|
|
|
|
=back
|
|
|
|
Just like alternation, quantifiers are also susceptible to
|
|
backtracking. Here is a step-by-step analysis of the example
|
|
|
|
$x = "the cat in the hat";
|
|
$x =~ /^(.*)(at)(.*)$/; # matches,
|
|
# $1 = 'the cat in the h'
|
|
# $2 = 'at'
|
|
# $3 = '' (0 matches)
|
|
|
|
=over 4
|
|
|
|
=item 0
|
|
|
|
Start with the first letter in the string 't'.
|
|
|
|
=item 1
|
|
|
|
The first quantifier '.*' starts out by matching the whole
|
|
string 'the cat in the hat'.
|
|
|
|
=item 2
|
|
|
|
'a' in the regexp element 'at' doesn't match the end of the
|
|
string. Backtrack one character.
|
|
|
|
=item 3
|
|
|
|
'a' in the regexp element 'at' still doesn't match the last
|
|
letter of the string 't', so backtrack one more character.
|
|
|
|
=item 4
|
|
|
|
Now we can match the 'a' and the 't'.
|
|
|
|
=item 5
|
|
|
|
Move on to the third element '.*'. Since we are at the end of
|
|
the string and '.*' can match 0 times, assign it the empty string.
|
|
|
|
=item 6
|
|
|
|
We are done!
|
|
|
|
=back
|
|
|
|
Most of the time, all this moving forward and backtracking happens
|
|
quickly and searching is fast. There are some pathological regexps,
|
|
however, whose execution time exponentially grows with the size of the
|
|
string. A typical structure that blows up in your face is of the form
|
|
|
|
/(a|b+)*/;
|
|
|
|
The problem is the nested indeterminate quantifiers. There are many
|
|
different ways of partitioning a string of length n between the C<+>
|
|
and C<*>: one repetition with C<b+> of length n, two repetitions with
|
|
the first C<b+> length k and the second with length n-k, m repetitions
|
|
whose bits add up to length n, etc. In fact there are an exponential
|
|
number of ways to partition a string as a function of length. A
|
|
regexp may get lucky and match early in the process, but if there is
|
|
no match, perl will try I<every> possibility before giving up. So be
|
|
careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
|
|
I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
|
|
discussion of this and other efficiency issues.
|
|
|
|
=head2 Building a regexp
|
|
|
|
At this point, we have all the basic regexp concepts covered, so let's
|
|
give a more involved example of a regular expression. We will build a
|
|
regexp that matches numbers.
|
|
|
|
The first task in building a regexp is to decide what we want to match
|
|
and what we want to exclude. In our case, we want to match both
|
|
integers and floating point numbers and we want to reject any string
|
|
that isn't a number.
|
|
|
|
The next task is to break the problem down into smaller problems that
|
|
are easily converted into a regexp.
|
|
|
|
The simplest case is integers. These consist of a sequence of digits,
|
|
with an optional sign in front. The digits we can represent with
|
|
C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
|
|
regexp is
|
|
|
|
/[+-]?\d+/; # matches integers
|
|
|
|
A floating point number potentially has a sign, an integral part, a
|
|
decimal point, a fractional part, and an exponent. One or more of these
|
|
parts is optional, so we need to check out the different
|
|
possibilities. Floating point numbers which are in proper form include
|
|
123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
|
|
front is completely optional and can be matched by C<[+-]?>. We can
|
|
see that if there is no exponent, floating point numbers must have a
|
|
decimal point, otherwise they are integers. We might be tempted to
|
|
model these with C<\d*\.\d*>, but this would also match just a single
|
|
decimal point, which is not a number. So the three cases of floating
|
|
point number sans exponent are
|
|
|
|
/[+-]?\d+\./; # 1., 321., etc.
|
|
/[+-]?\.\d+/; # .1, .234, etc.
|
|
/[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
|
|
|
|
These can be combined into a single regexp with a three-way alternation:
|
|
|
|
/[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
|
|
|
|
In this alternation, it is important to put C<'\d+\.\d+'> before
|
|
C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
|
|
and ignore the fractional part of the number.
|
|
|
|
Now consider floating point numbers with exponents. The key
|
|
observation here is that I<both> integers and numbers with decimal
|
|
points are allowed in front of an exponent. Then exponents, like the
|
|
overall sign, are independent of whether we are matching numbers with
|
|
or without decimal points, and can be 'decoupled' from the
|
|
mantissa. The overall form of the regexp now becomes clear:
|
|
|
|
/^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
|
|
|
|
The exponent is an C<e> or C<E>, followed by an integer. So the
|
|
exponent regexp is
|
|
|
|
/[eE][+-]?\d+/; # exponent
|
|
|
|
Putting all the parts together, we get a regexp that matches numbers:
|
|
|
|
/^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
|
|
|
|
Long regexps like this may impress your friends, but can be hard to
|
|
decipher. In complex situations like this, the C<//x> modifier for a
|
|
match is invaluable. It allows one to put nearly arbitrary whitespace
|
|
and comments into a regexp without affecting their meaning. Using it,
|
|
we can rewrite our 'extended' regexp in the more pleasing form
|
|
|
|
/^
|
|
[+-]? # first, match an optional sign
|
|
( # then match integers or f.p. mantissas:
|
|
\d+\.\d+ # mantissa of the form a.b
|
|
|\d+\. # mantissa of the form a.
|
|
|\.\d+ # mantissa of the form .b
|
|
|\d+ # integer of the form a
|
|
)
|
|
([eE][+-]?\d+)? # finally, optionally match an exponent
|
|
$/x;
|
|
|
|
If whitespace is mostly irrelevant, how does one include space
|
|
characters in an extended regexp? The answer is to backslash it
|
|
S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
|
|
goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
|
|
a space between the sign and the mantissa/integer, and we could add
|
|
this to our regexp as follows:
|
|
|
|
/^
|
|
[+-]?\ * # first, match an optional sign *and space*
|
|
( # then match integers or f.p. mantissas:
|
|
\d+\.\d+ # mantissa of the form a.b
|
|
|\d+\. # mantissa of the form a.
|
|
|\.\d+ # mantissa of the form .b
|
|
|\d+ # integer of the form a
|
|
)
|
|
([eE][+-]?\d+)? # finally, optionally match an exponent
|
|
$/x;
|
|
|
|
In this form, it is easier to see a way to simplify the
|
|
alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
|
|
could be factored out:
|
|
|
|
/^
|
|
[+-]?\ * # first, match an optional sign
|
|
( # then match integers or f.p. mantissas:
|
|
\d+ # start out with a ...
|
|
(
|
|
\.\d* # mantissa of the form a.b or a.
|
|
)? # ? takes care of integers of the form a
|
|
|\.\d+ # mantissa of the form .b
|
|
)
|
|
([eE][+-]?\d+)? # finally, optionally match an exponent
|
|
$/x;
|
|
|
|
or written in the compact form,
|
|
|
|
/^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
|
|
|
|
This is our final regexp. To recap, we built a regexp by
|
|
|
|
=over 4
|
|
|
|
=item *
|
|
|
|
specifying the task in detail,
|
|
|
|
=item *
|
|
|
|
breaking down the problem into smaller parts,
|
|
|
|
=item *
|
|
|
|
translating the small parts into regexps,
|
|
|
|
=item *
|
|
|
|
combining the regexps,
|
|
|
|
=item *
|
|
|
|
and optimizing the final combined regexp.
|
|
|
|
=back
|
|
|
|
These are also the typical steps involved in writing a computer
|
|
program. This makes perfect sense, because regular expressions are
|
|
essentially programs written a little computer language that specifies
|
|
patterns.
|
|
|
|
=head2 Using regular expressions in Perl
|
|
|
|
The last topic of Part 1 briefly covers how regexps are used in Perl
|
|
programs. Where do they fit into Perl syntax?
|
|
|
|
We have already introduced the matching operator in its default
|
|
C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
|
|
the binding operator C<=~> and its negation C<!~> to test for string
|
|
matches. Associated with the matching operator, we have discussed the
|
|
single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
|
|
extended C<//x> modifiers.
|
|
|
|
There are a few more things you might want to know about matching
|
|
operators. First, we pointed out earlier that variables in regexps are
|
|
substituted before the regexp is evaluated:
|
|
|
|
$pattern = 'Seuss';
|
|
while (<>) {
|
|
print if /$pattern/;
|
|
}
|
|
|
|
This will print any lines containing the word C<Seuss>. It is not as
|
|
efficient as it could be, however, because perl has to re-evaluate
|
|
C<$pattern> each time through the loop. If C<$pattern> won't be
|
|
changing over the lifetime of the script, we can add the C<//o>
|
|
modifier, which directs perl to only perform variable substitutions
|
|
once:
|
|
|
|
#!/usr/bin/perl
|
|
# Improved simple_grep
|
|
$regexp = shift;
|
|
while (<>) {
|
|
print if /$regexp/o; # a good deal faster
|
|
}
|
|
|
|
If you change C<$pattern> after the first substitution happens, perl
|
|
will ignore it. If you don't want any substitutions at all, use the
|
|
special delimiter C<m''>:
|
|
|
|
$pattern = 'Seuss';
|
|
while (<>) {
|
|
print if m'$pattern'; # matches '$pattern', not 'Seuss'
|
|
}
|
|
|
|
C<m''> acts like single quotes on a regexp; all other C<m> delimiters
|
|
act like double quotes. If the regexp evaluates to the empty string,
|
|
the regexp in the I<last successful match> is used instead. So we have
|
|
|
|
"dog" =~ /d/; # 'd' matches
|
|
"dogbert =~ //; # this matches the 'd' regexp used before
|
|
|
|
The final two modifiers C<//g> and C<//c> concern multiple matches.
|
|
The modifier C<//g> stands for global matching and allows the the
|
|
matching operator to match within a string as many times as possible.
|
|
In scalar context, successive invocations against a string will have
|
|
`C<//g> jump from match to match, keeping track of position in the
|
|
string as it goes along. You can get or set the position with the
|
|
C<pos()> function.
|
|
|
|
The use of C<//g> is shown in the following example. Suppose we have
|
|
a string that consists of words separated by spaces. If we know how
|
|
many words there are in advance, we could extract the words using
|
|
groupings:
|
|
|
|
$x = "cat dog house"; # 3 words
|
|
$x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
|
|
# $1 = 'cat'
|
|
# $2 = 'dog'
|
|
# $3 = 'house'
|
|
|
|
But what if we had an indeterminate number of words? This is the sort
|
|
of task C<//g> was made for. To extract all words, form the simple
|
|
regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
|
|
|
|
while ($x =~ /(\w+)/g) {
|
|
print "Word is $1, ends at position ", pos $x, "\n";
|
|
}
|
|
|
|
prints
|
|
|
|
Word is cat, ends at position 3
|
|
Word is dog, ends at position 7
|
|
Word is house, ends at position 13
|
|
|
|
A failed match or changing the target string resets the position. If
|
|
you don't want the position reset after failure to match, add the
|
|
C<//c>, as in C</regexp/gc>. The current position in the string is
|
|
associated with the string, not the regexp. This means that different
|
|
strings have different positions and their respective positions can be
|
|
set or read independently.
|
|
|
|
In list context, C<//g> returns a list of matched groupings, or if
|
|
there are no groupings, a list of matches to the whole regexp. So if
|
|
we wanted just the words, we could use
|
|
|
|
@words = ($x =~ /(\w+)/g); # matches,
|
|
# $word[0] = 'cat'
|
|
# $word[1] = 'dog'
|
|
# $word[2] = 'house'
|
|
|
|
Closely associated with the C<//g> modifier is the C<\G> anchor. The
|
|
C<\G> anchor matches at the point where the previous C<//g> match left
|
|
off. C<\G> allows us to easily do context-sensitive matching:
|
|
|
|
$metric = 1; # use metric units
|
|
...
|
|
$x = <FILE>; # read in measurement
|
|
$x =~ /^([+-]?\d+)\s*/g; # get magnitude
|
|
$weight = $1;
|
|
if ($metric) { # error checking
|
|
print "Units error!" unless $x =~ /\Gkg\./g;
|
|
}
|
|
else {
|
|
print "Units error!" unless $x =~ /\Glbs\./g;
|
|
}
|
|
$x =~ /\G\s+(widget|sprocket)/g; # continue processing
|
|
|
|
The combination of C<//g> and C<\G> allows us to process the string a
|
|
bit at a time and use arbitrary Perl logic to decide what to do next.
|
|
|
|
C<\G> is also invaluable in processing fixed length records with
|
|
regexps. Suppose we have a snippet of coding region DNA, encoded as
|
|
base pair letters C<ATCGTTGAAT...> and we want to find all the stop
|
|
codons C<TGA>. In a coding region, codons are 3-letter sequences, so
|
|
we can think of the DNA snippet as a sequence of 3-letter records. The
|
|
naive regexp
|
|
|
|
# expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
|
|
$dna = "ATCGTTGAATGCAAATGACATGAC";
|
|
$dna =~ /TGA/;
|
|
|
|
doesn't work; it may match an C<TGA>, but there is no guarantee that
|
|
the match is aligned with codon boundaries, e.g., the substring
|
|
S<C<GTT GAA> > gives a match. A better solution is
|
|
|
|
while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
|
|
print "Got a TGA stop codon at position ", pos $dna, "\n";
|
|
}
|
|
|
|
which prints
|
|
|
|
Got a TGA stop codon at position 18
|
|
Got a TGA stop codon at position 23
|
|
|
|
Position 18 is good, but position 23 is bogus. What happened?
|
|
|
|
The answer is that our regexp works well until we get past the last
|
|
real match. Then the regexp will fail to match a synchronized C<TGA>
|
|
and start stepping ahead one character position at a time, not what we
|
|
want. The solution is to use C<\G> to anchor the match to the codon
|
|
alignment:
|
|
|
|
while ($dna =~ /\G(\w\w\w)*?TGA/g) {
|
|
print "Got a TGA stop codon at position ", pos $dna, "\n";
|
|
}
|
|
|
|
This prints
|
|
|
|
Got a TGA stop codon at position 18
|
|
|
|
which is the correct answer. This example illustrates that it is
|
|
important not only to match what is desired, but to reject what is not
|
|
desired.
|
|
|
|
B<search and replace>
|
|
|
|
Regular expressions also play a big role in B<search and replace>
|
|
operations in Perl. Search and replace is accomplished with the
|
|
C<s///> operator. The general form is
|
|
C<s/regexp/replacement/modifiers>, with everything we know about
|
|
regexps and modifiers applying in this case as well. The
|
|
C<replacement> is a Perl double quoted string that replaces in the
|
|
string whatever is matched with the C<regexp>. The operator C<=~> is
|
|
also used here to associate a string with C<s///>. If matching
|
|
against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
|
|
C<s///> returns the number of substitutions made, otherwise it returns
|
|
false. Here are a few examples:
|
|
|
|
$x = "Time to feed the cat!";
|
|
$x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
|
|
if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
|
|
$more_insistent = 1;
|
|
}
|
|
$y = "'quoted words'";
|
|
$y =~ s/^'(.*)'$/$1/; # strip single quotes,
|
|
# $y contains "quoted words"
|
|
|
|
In the last example, the whole string was matched, but only the part
|
|
inside the single quotes was grouped. With the C<s///> operator, the
|
|
matched variables C<$1>, C<$2>, etc. are immediately available for use
|
|
in the replacement expression, so we use C<$1> to replace the quoted
|
|
string with just what was quoted. With the global modifier, C<s///g>
|
|
will search and replace all occurrences of the regexp in the string:
|
|
|
|
$x = "I batted 4 for 4";
|
|
$x =~ s/4/four/; # doesn't do it all:
|
|
# $x contains "I batted four for 4"
|
|
$x = "I batted 4 for 4";
|
|
$x =~ s/4/four/g; # does it all:
|
|
# $x contains "I batted four for four"
|
|
|
|
If you prefer 'regex' over 'regexp' in this tutorial, you could use
|
|
the following program to replace it:
|
|
|
|
% cat > simple_replace
|
|
#!/usr/bin/perl
|
|
$regexp = shift;
|
|
$replacement = shift;
|
|
while (<>) {
|
|
s/$regexp/$replacement/go;
|
|
print;
|
|
}
|
|
^D
|
|
|
|
% simple_replace regexp regex perlretut.pod
|
|
|
|
In C<simple_replace> we used the C<s///g> modifier to replace all
|
|
occurrences of the regexp on each line and the C<s///o> modifier to
|
|
compile the regexp only once. As with C<simple_grep>, both the
|
|
C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
|
|
|
|
A modifier available specifically to search and replace is the
|
|
C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
|
|
the replacement string and the evaluated result is substituted for the
|
|
matched substring. C<s///e> is useful if you need to do a bit of
|
|
computation in the process of replacing text. This example counts
|
|
character frequencies in a line:
|
|
|
|
$x = "Bill the cat";
|
|
$x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
|
|
print "frequency of '$_' is $chars{$_}\n"
|
|
foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
|
|
|
|
This prints
|
|
|
|
frequency of ' ' is 2
|
|
frequency of 't' is 2
|
|
frequency of 'l' is 2
|
|
frequency of 'B' is 1
|
|
frequency of 'c' is 1
|
|
frequency of 'e' is 1
|
|
frequency of 'h' is 1
|
|
frequency of 'i' is 1
|
|
frequency of 'a' is 1
|
|
|
|
As with the match C<m//> operator, C<s///> can use other delimiters,
|
|
such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
|
|
used C<s'''>, then the regexp and replacement are treated as single
|
|
quoted strings and there are no substitutions. C<s///> in list context
|
|
returns the same thing as in scalar context, i.e., the number of
|
|
matches.
|
|
|
|
B<The split operator>
|
|
|
|
The B<C<split> > function can also optionally use a matching operator
|
|
C<m//> to split a string. C<split /regexp/, string, limit> splits
|
|
C<string> into a list of substrings and returns that list. The regexp
|
|
is used to match the character sequence that the C<string> is split
|
|
with respect to. The C<limit>, if present, constrains splitting into
|
|
no more than C<limit> number of strings. For example, to split a
|
|
string into words, use
|
|
|
|
$x = "Calvin and Hobbes";
|
|
@words = split /\s+/, $x; # $word[0] = 'Calvin'
|
|
# $word[1] = 'and'
|
|
# $word[2] = 'Hobbes'
|
|
|
|
If the empty regexp C<//> is used, the regexp always matches and
|
|
the string is split into individual characters. If the regexp has
|
|
groupings, then list produced contains the matched substrings from the
|
|
groupings as well. For instance,
|
|
|
|
$x = "/usr/bin/perl";
|
|
@dirs = split m!/!, $x; # $dirs[0] = ''
|
|
# $dirs[1] = 'usr'
|
|
# $dirs[2] = 'bin'
|
|
# $dirs[3] = 'perl'
|
|
@parts = split m!(/)!, $x; # $parts[0] = ''
|
|
# $parts[1] = '/'
|
|
# $parts[2] = 'usr'
|
|
# $parts[3] = '/'
|
|
# $parts[4] = 'bin'
|
|
# $parts[5] = '/'
|
|
# $parts[6] = 'perl'
|
|
|
|
Since the first character of $x matched the regexp, C<split> prepended
|
|
an empty initial element to the list.
|
|
|
|
If you have read this far, congratulations! You now have all the basic
|
|
tools needed to use regular expressions to solve a wide range of text
|
|
processing problems. If this is your first time through the tutorial,
|
|
why not stop here and play around with regexps a while... S<Part 2>
|
|
concerns the more esoteric aspects of regular expressions and those
|
|
concepts certainly aren't needed right at the start.
|
|
|
|
=head1 Part 2: Power tools
|
|
|
|
OK, you know the basics of regexps and you want to know more. If
|
|
matching regular expressions is analogous to a walk in the woods, then
|
|
the tools discussed in Part 1 are analogous to topo maps and a
|
|
compass, basic tools we use all the time. Most of the tools in part 2
|
|
are are analogous to flare guns and satellite phones. They aren't used
|
|
too often on a hike, but when we are stuck, they can be invaluable.
|
|
|
|
What follows are the more advanced, less used, or sometimes esoteric
|
|
capabilities of perl regexps. In Part 2, we will assume you are
|
|
comfortable with the basics and concentrate on the new features.
|
|
|
|
=head2 More on characters, strings, and character classes
|
|
|
|
There are a number of escape sequences and character classes that we
|
|
haven't covered yet.
|
|
|
|
There are several escape sequences that convert characters or strings
|
|
between upper and lower case. C<\l> and C<\u> convert the next
|
|
character to lower or upper case, respectively:
|
|
|
|
$x = "perl";
|
|
$string =~ /\u$x/; # matches 'Perl' in $string
|
|
$x = "M(rs?|s)\\."; # note the double backslash
|
|
$string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
|
|
|
|
C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
|
|
C<\U> and C<\E>, to lower or upper case:
|
|
|
|
$x = "This word is in lower case:\L SHOUT\E";
|
|
$x =~ /shout/; # matches
|
|
$x = "I STILL KEYPUNCH CARDS FOR MY 360"
|
|
$x =~ /\Ukeypunch/; # matches punch card string
|
|
|
|
If there is no C<\E>, case is converted until the end of the
|
|
string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
|
|
character of C<$word> to uppercase and the rest of the characters to
|
|
lowercase.
|
|
|
|
Control characters can be escaped with C<\c>, so that a control-Z
|
|
character would be matched with C<\cZ>. The escape sequence
|
|
C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
|
|
instance,
|
|
|
|
$x = "\QThat !^*&%~& cat!";
|
|
$x =~ /\Q!^*&%~&\E/; # check for rough language
|
|
|
|
It does not protect C<$> or C<@>, so that variables can still be
|
|
substituted.
|
|
|
|
With the advent of 5.6.0, perl regexps can handle more than just the
|
|
standard ASCII character set. Perl now supports B<Unicode>, a standard
|
|
for encoding the character sets from many of the world's written
|
|
languages. Unicode does this by allowing characters to be more than
|
|
one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
|
|
are still encoded as one byte, but characters greater than C<chr(127)>
|
|
may be stored as two or more bytes.
|
|
|
|
What does this mean for regexps? Well, regexp users don't need to know
|
|
much about perl's internal representation of strings. But they do need
|
|
to know 1) how to represent Unicode characters in a regexp and 2) when
|
|
a matching operation will treat the string to be searched as a
|
|
sequence of bytes (the old way) or as a sequence of Unicode characters
|
|
(the new way). The answer to 1) is that Unicode characters greater
|
|
than C<chr(127)> may be represented using the C<\x{hex}> notation,
|
|
with C<hex> a hexadecimal integer:
|
|
|
|
use utf8; # We will be doing Unicode processing
|
|
/\x{263a}/; # match a Unicode smiley face :)
|
|
|
|
Unicode characters in the range of 128-255 use two hexadecimal digits
|
|
with braces: C<\x{ab}>. Note that this is different than C<\xab>,
|
|
which is just a hexadecimal byte with no Unicode
|
|
significance.
|
|
|
|
Figuring out the hexadecimal sequence of a Unicode character you want
|
|
or deciphering someone else's hexadecimal Unicode regexp is about as
|
|
much fun as programming in machine code. So another way to specify
|
|
Unicode characters is to use the S<B<named character> > escape
|
|
sequence C<\N{name}>. C<name> is a name for the Unicode character, as
|
|
specified in the Unicode standard. For instance, if we wanted to
|
|
represent or match the astrological sign for the planet Mercury, we
|
|
could use
|
|
|
|
use utf8; # We will be doing Unicode processing
|
|
use charnames ":full"; # use named chars with Unicode full names
|
|
$x = "abc\N{MERCURY}def";
|
|
$x =~ /\N{MERCURY}/; # matches
|
|
|
|
One can also use short names or restrict names to a certain alphabet:
|
|
|
|
use utf8; # We will be doing Unicode processing
|
|
|
|
use charnames ':full';
|
|
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
|
|
|
|
use charnames ":short";
|
|
print "\N{greek:Sigma} is an upper-case sigma.\n";
|
|
|
|
use charnames qw(greek);
|
|
print "\N{sigma} is Greek sigma\n";
|
|
|
|
A list of full names is found in the file Names.txt in the
|
|
lib/perl5/5.6.0/unicode directory.
|
|
|
|
The answer to requirement 2), as of 5.6.0, is that if a regexp
|
|
contains Unicode characters, the string is searched as a sequence of
|
|
Unicode characters. Otherwise, the string is searched as a sequence of
|
|
bytes. If the string is being searched as a sequence of Unicode
|
|
characters, but matching a single byte is required, we can use the C<\C>
|
|
escape sequence. C<\C> is a character class akin to C<.> except that
|
|
it matches I<any> byte 0-255. So
|
|
|
|
use utf8; # We will be doing Unicode processing
|
|
use charnames ":full"; # use named chars with Unicode full names
|
|
$x = "a";
|
|
$x =~ /\C/; # matches 'a', eats one byte
|
|
$x = "";
|
|
$x =~ /\C/; # doesn't match, no bytes to match
|
|
$x = "\N{MERCURY}"; # two-byte Unicode character
|
|
$x =~ /\C/; # matches, but dangerous!
|
|
|
|
The last regexp matches, but is dangerous because the string
|
|
I<character> position is no longer synchronized to the string I<byte>
|
|
position. This generates the warning 'Malformed UTF-8
|
|
character'. C<\C> is best used for matching the binary data in strings
|
|
with binary data intermixed with Unicode characters.
|
|
|
|
Let us now discuss the rest of the character classes. Just as with
|
|
Unicode characters, there are named Unicode character classes
|
|
represented by the C<\p{name}> escape sequence. Closely associated is
|
|
the C<\P{name}> character class, which is the negation of the
|
|
C<\p{name}> class. For example, to match lower and uppercase
|
|
characters,
|
|
|
|
use utf8; # We will be doing Unicode processing
|
|
use charnames ":full"; # use named chars with Unicode full names
|
|
$x = "BOB";
|
|
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
|
|
$x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
|
|
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
|
|
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase
|
|
|
|
Here is the association between some Perl named classes and the
|
|
traditional Unicode classes:
|
|
|
|
Perl class name Unicode class name or regular expression
|
|
|
|
IsAlpha /^[LM]/
|
|
IsAlnum /^[LMN]/
|
|
IsASCII $code <= 127
|
|
IsCntrl /^C/
|
|
IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
|
|
IsDigit Nd
|
|
IsGraph /^([LMNPS]|Co)/
|
|
IsLower Ll
|
|
IsPrint /^([LMNPS]|Co|Zs)/
|
|
IsPunct /^P/
|
|
IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
|
|
IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D)$/
|
|
IsUpper /^L[ut]/
|
|
IsWord /^[LMN]/ || $code eq "005F"
|
|
IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
|
|
|
|
You can also use the official Unicode class names with the C<\p> and
|
|
C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
|
|
letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
|
|
letter, the braces can be dropped. For instance, C<\pM> is the
|
|
character class of Unicode 'marks'.
|
|
|
|
C<\X> is an abbreviation for a character class sequence that includes
|
|
the Unicode 'combining character sequences'. A 'combining character
|
|
sequence' is a base character followed by any number of combining
|
|
characters. An example of a combining character is an accent. Using
|
|
the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
|
|
character sequence with base character C<A> and combining character
|
|
S<C<COMBINING RING> >, which translates in Danish to A with the circle
|
|
atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
|
|
i.e., a non-mark followed by one or more marks.
|
|
|
|
As if all those classes weren't enough, Perl also defines POSIX style
|
|
character classes. These have the form C<[:name:]>, with C<name> the
|
|
name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
|
|
C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
|
|
C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
|
|
extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
|
|
is being used, then these classes are defined the same as their
|
|
corresponding perl Unicode classes: C<[:upper:]> is the same as
|
|
C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
|
|
require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
|
|
C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
|
|
character classes. To negate a POSIX class, put a C<^> in front of
|
|
the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
|
|
C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
|
|
be used just like C<\d>, both inside and outside of character classes:
|
|
|
|
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
|
|
/^=item\s[:digit:]/; # match '=item',
|
|
# followed by a space and a digit
|
|
use utf8;
|
|
use charnames ":full";
|
|
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
|
|
/^=item\s\p{IsDigit}/; # match '=item',
|
|
# followed by a space and a digit
|
|
|
|
Whew! That is all the rest of the characters and character classes.
|
|
|
|
=head2 Compiling and saving regular expressions
|
|
|
|
In Part 1 we discussed the C<//o> modifier, which compiles a regexp
|
|
just once. This suggests that a compiled regexp is some data structure
|
|
that can be stored once and used again and again. The regexp quote
|
|
C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
|
|
regexp and transforms the result into a form that can be assigned to a
|
|
variable:
|
|
|
|
$reg = qr/foo+bar?/; # reg contains a compiled regexp
|
|
|
|
Then C<$reg> can be used as a regexp:
|
|
|
|
$x = "fooooba";
|
|
$x =~ $reg; # matches, just like /foo+bar?/
|
|
$x =~ /$reg/; # same thing, alternate form
|
|
|
|
C<$reg> can also be interpolated into a larger regexp:
|
|
|
|
$x =~ /(abc)?$reg/; # still matches
|
|
|
|
As with the matching operator, the regexp quote can use different
|
|
delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
|
|
delimiters C<qr''> prevent any interpolation from taking place.
|
|
|
|
Pre-compiled regexps are useful for creating dynamic matches that
|
|
don't need to be recompiled each time they are encountered. Using
|
|
pre-compiled regexps, C<simple_grep> program can be expanded into a
|
|
program that matches multiple patterns:
|
|
|
|
% cat > multi_grep
|
|
#!/usr/bin/perl
|
|
# multi_grep - match any of <number> regexps
|
|
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
|
|
|
|
$number = shift;
|
|
$regexp[$_] = shift foreach (0..$number-1);
|
|
@compiled = map qr/$_/, @regexp;
|
|
while ($line = <>) {
|
|
foreach $pattern (@compiled) {
|
|
if ($line =~ /$pattern/) {
|
|
print $line;
|
|
last; # we matched, so move onto the next line
|
|
}
|
|
}
|
|
}
|
|
^D
|
|
|
|
% multi_grep 2 last for multi_grep
|
|
$regexp[$_] = shift foreach (0..$number-1);
|
|
foreach $pattern (@compiled) {
|
|
last;
|
|
|
|
Storing pre-compiled regexps in an array C<@compiled> allows us to
|
|
simply loop through the regexps without any recompilation, thus gaining
|
|
flexibility without sacrificing speed.
|
|
|
|
=head2 Embedding comments and modifiers in a regular expression
|
|
|
|
Starting with this section, we will be discussing Perl's set of
|
|
B<extended patterns>. These are extensions to the traditional regular
|
|
expression syntax that provide powerful new tools for pattern
|
|
matching. We have already seen extensions in the form of the minimal
|
|
matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
|
|
rest of the extensions below have the form C<(?char...)>, where the
|
|
C<char> is a character that determines the type of extension.
|
|
|
|
The first extension is an embedded comment C<(?#text)>. This embeds a
|
|
comment into the regular expression without affecting its meaning. The
|
|
comment should not have any closing parentheses in the text. An
|
|
example is
|
|
|
|
/(?# Match an integer:)[+-]?\d+/;
|
|
|
|
This style of commenting has been largely superseded by the raw,
|
|
freeform commenting that is allowed with the C<//x> modifier.
|
|
|
|
The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
|
|
a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
|
|
|
|
/(?i)yes/; # match 'yes' case insensitively
|
|
/yes/i; # same thing
|
|
/(?x)( # freeform version of an integer regexp
|
|
[+-]? # match an optional sign
|
|
\d+ # match a sequence of digits
|
|
)
|
|
/x;
|
|
|
|
Embedded modifiers can have two important advantages over the usual
|
|
modifiers. Embedded modifiers allow a custom set of modifiers to
|
|
I<each> regexp pattern. This is great for matching an array of regexps
|
|
that must have different modifiers:
|
|
|
|
$pattern[0] = '(?i)doctor';
|
|
$pattern[1] = 'Johnson';
|
|
...
|
|
while (<>) {
|
|
foreach $patt (@pattern) {
|
|
print if /$patt/;
|
|
}
|
|
}
|
|
|
|
The second advantage is that embedded modifiers only affect the regexp
|
|
inside the group the embedded modifier is contained in. So grouping
|
|
can be used to localize the modifier's effects:
|
|
|
|
/Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
|
|
|
|
Embedded modifiers can also turn off any modifiers already present
|
|
by using, e.g., C<(?-i)>. Modifiers can also be combined into
|
|
a single expression, e.g., C<(?s-i)> turns on single line mode and
|
|
turns off case insensitivity.
|
|
|
|
=head2 Non-capturing groupings
|
|
|
|
We noted in Part 1 that groupings C<()> had two distinct functions: 1)
|
|
group regexp elements together as a single unit, and 2) extract, or
|
|
capture, substrings that matched the regexp in the
|
|
grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
|
|
regexp to be treated as a single unit, but don't extract substrings or
|
|
set matching variables C<$1>, etc. Both capturing and non-capturing
|
|
groupings are allowed to co-exist in the same regexp. Because there is
|
|
no extraction, non-capturing groupings are faster than capturing
|
|
groupings. Non-capturing groupings are also handy for choosing exactly
|
|
which parts of a regexp are to be extracted to matching variables:
|
|
|
|
# match a number, $1-$4 are set, but we only want $1
|
|
/([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
|
|
|
|
# match a number faster , only $1 is set
|
|
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
|
|
|
|
# match a number, get $1 = whole number, $2 = exponent
|
|
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
|
|
|
|
Non-capturing groupings are also useful for removing nuisance
|
|
elements gathered from a split operation:
|
|
|
|
$x = '12a34b5';
|
|
@num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
|
|
@num = split /(?:a|b)/, $x; # @num = ('12','34','5')
|
|
|
|
Non-capturing groupings may also have embedded modifiers:
|
|
C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
|
|
case insensitively and turns off multi-line mode.
|
|
|
|
=head2 Looking ahead and looking behind
|
|
|
|
This section concerns the lookahead and lookbehind assertions. First,
|
|
a little background.
|
|
|
|
In Perl regular expressions, most regexp elements 'eat up' a certain
|
|
amount of string when they match. For instance, the regexp element
|
|
C<[abc}]> eats up one character of the string when it matches, in the
|
|
sense that perl moves to the next character position in the string
|
|
after the match. There are some elements, however, that don't eat up
|
|
characters (advance the character position) if they match. The examples
|
|
we have seen so far are the anchors. The anchor C<^> matches the
|
|
beginning of the line, but doesn't eat any characters. Similarly, the
|
|
word boundary anchor C<\b> matches, e.g., if the character to the left
|
|
is a word character and the character to the right is a non-word
|
|
character, but it doesn't eat up any characters itself. Anchors are
|
|
examples of 'zero-width assertions'. Zero-width, because they consume
|
|
no characters, and assertions, because they test some property of the
|
|
string. In the context of our walk in the woods analogy to regexp
|
|
matching, most regexp elements move us along a trail, but anchors have
|
|
us stop a moment and check our surroundings. If the local environment
|
|
checks out, we can proceed forward. But if the local environment
|
|
doesn't satisfy us, we must backtrack.
|
|
|
|
Checking the environment entails either looking ahead on the trail,
|
|
looking behind, or both. C<^> looks behind, to see that there are no
|
|
characters before. C<$> looks ahead, to see that there are no
|
|
characters after. C<\b> looks both ahead and behind, to see if the
|
|
characters on either side differ in their 'word'-ness.
|
|
|
|
The lookahead and lookbehind assertions are generalizations of the
|
|
anchor concept. Lookahead and lookbehind are zero-width assertions
|
|
that let us specify which characters we want to test for. The
|
|
lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
|
|
assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
|
|
|
|
$x = "I catch the housecat 'Tom-cat' with catnip";
|
|
$x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
|
|
@catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
|
|
# $catwords[0] = 'catch'
|
|
# $catwords[1] = 'catnip'
|
|
$x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
|
|
$x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
|
|
# middle of $x
|
|
|
|
Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
|
|
non-capturing, since these are zero-width assertions. Thus in the
|
|
second regexp, the substrings captured are those of the whole regexp
|
|
itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
|
|
lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
|
|
width, i.e., a fixed number of characters long. Thus
|
|
C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
|
|
negated versions of the lookahead and lookbehind assertions are
|
|
denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
|
|
They evaluate true if the regexps do I<not> match:
|
|
|
|
$x = "foobar";
|
|
$x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
|
|
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
|
|
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
|
|
|
|
=head2 Using independent subexpressions to prevent backtracking
|
|
|
|
The last few extended patterns in this tutorial are experimental as of
|
|
5.6.0. Play with them, use them in some code, but don't rely on them
|
|
just yet for production code.
|
|
|
|
S<B<Independent subexpressions> > are regular expressions, in the
|
|
context of a larger regular expression, that function independently of
|
|
the larger regular expression. That is, they consume as much or as
|
|
little of the string as they wish without regard for the ability of
|
|
the larger regexp to match. Independent subexpressions are represented
|
|
by C<< (?>regexp) >>. We can illustrate their behavior by first
|
|
considering an ordinary regexp:
|
|
|
|
$x = "ab";
|
|
$x =~ /a*ab/; # matches
|
|
|
|
This obviously matches, but in the process of matching, the
|
|
subexpression C<a*> first grabbed the C<a>. Doing so, however,
|
|
wouldn't allow the whole regexp to match, so after backtracking, C<a*>
|
|
eventually gave back the C<a> and matched the empty string. Here, what
|
|
C<a*> matched was I<dependent> on what the rest of the regexp matched.
|
|
|
|
Contrast that with an independent subexpression:
|
|
|
|
$x =~ /(?>a*)ab/; # doesn't match!
|
|
|
|
The independent subexpression C<< (?>a*) >> doesn't care about the rest
|
|
of the regexp, so it sees an C<a> and grabs it. Then the rest of the
|
|
regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
|
|
is no backtracking and and the independent subexpression does not give
|
|
up its C<a>. Thus the match of the regexp as a whole fails. A similar
|
|
behavior occurs with completely independent regexps:
|
|
|
|
$x = "ab";
|
|
$x =~ /a*/g; # matches, eats an 'a'
|
|
$x =~ /\Gab/g; # doesn't match, no 'a' available
|
|
|
|
Here C<//g> and C<\G> create a 'tag team' handoff of the string from
|
|
one regexp to the other. Regexps with an independent subexpression are
|
|
much like this, with a handoff of the string to the independent
|
|
subexpression, and a handoff of the string back to the enclosing
|
|
regexp.
|
|
|
|
The ability of an independent subexpression to prevent backtracking
|
|
can be quite useful. Suppose we want to match a non-empty string
|
|
enclosed in parentheses up to two levels deep. Then the following
|
|
regexp matches:
|
|
|
|
$x = "abc(de(fg)h"; # unbalanced parentheses
|
|
$x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
|
|
|
|
The regexp matches an open parenthesis, one or more copies of an
|
|
alternation, and a close parenthesis. The alternation is two-way, with
|
|
the first alternative C<[^()]+> matching a substring with no
|
|
parentheses and the second alternative C<\([^()]*\)> matching a
|
|
substring delimited by parentheses. The problem with this regexp is
|
|
that it is pathological: it has nested indeterminate quantifiers
|
|
of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
|
|
like this could take an exponentially long time to execute if there
|
|
was no match possible. To prevent the exponential blowup, we need to
|
|
prevent useless backtracking at some point. This can be done by
|
|
enclosing the inner quantifier as an independent subexpression:
|
|
|
|
$x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
|
|
|
|
Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
|
|
by gobbling up as much of the string as possible and keeping it. Then
|
|
match failures fail much more quickly.
|
|
|
|
=head2 Conditional expressions
|
|
|
|
A S<B<conditional expression> > is a form of if-then-else statement
|
|
that allows one to choose which patterns are to be matched, based on
|
|
some condition. There are two types of conditional expression:
|
|
C<(?(condition)yes-regexp)> and
|
|
C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
|
|
like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
|
|
the C<yes-regexp> will be matched. If the C<condition> is false, the
|
|
C<yes-regexp> will be skipped and perl will move onto the next regexp
|
|
element. The second form is like an S<C<'if () {} else {}'> > statement
|
|
in Perl. If the C<condition> is true, the C<yes-regexp> will be
|
|
matched, otherwise the C<no-regexp> will be matched.
|
|
|
|
The C<condition> can have two forms. The first form is simply an
|
|
integer in parentheses C<(integer)>. It is true if the corresponding
|
|
backreference C<\integer> matched earlier in the regexp. The second
|
|
form is a bare zero width assertion C<(?...)>, either a
|
|
lookahead, a lookbehind, or a code assertion (discussed in the next
|
|
section).
|
|
|
|
The integer form of the C<condition> allows us to choose, with more
|
|
flexibility, what to match based on what matched earlier in the
|
|
regexp. This searches for words of the form C<"$x$x"> or
|
|
C<"$x$y$y$x">:
|
|
|
|
% simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
|
|
beriberi
|
|
coco
|
|
couscous
|
|
deed
|
|
...
|
|
toot
|
|
toto
|
|
tutu
|
|
|
|
The lookbehind C<condition> allows, along with backreferences,
|
|
an earlier part of the match to influence a later part of the
|
|
match. For instance,
|
|
|
|
/[ATGC]+(?(?<=AA)G|C)$/;
|
|
|
|
matches a DNA sequence such that it either ends in C<AAG>, or some
|
|
other base pair combination and C<C>. Note that the form is
|
|
C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
|
|
lookahead, lookbehind or code assertions, the parentheses around the
|
|
conditional are not needed.
|
|
|
|
=head2 A bit of magic: executing Perl code in a regular expression
|
|
|
|
Normally, regexps are a part of Perl expressions.
|
|
S<B<Code evaluation> > expressions turn that around by allowing
|
|
arbitrary Perl code to be a part of of a regexp. A code evaluation
|
|
expression is denoted C<(?{code})>, with C<code> a string of Perl
|
|
statements.
|
|
|
|
Code expressions are zero-width assertions, and the value they return
|
|
depends on their environment. There are two possibilities: either the
|
|
code expression is used as a conditional in a conditional expression
|
|
C<(?(condition)...)>, or it is not. If the code expression is a
|
|
conditional, the code is evaluated and the result (i.e., the result of
|
|
the last statement) is used to determine truth or falsehood. If the
|
|
code expression is not used as a conditional, the assertion always
|
|
evaluates true and the result is put into the special variable
|
|
C<$^R>. The variable C<$^R> can then be used in code expressions later
|
|
in the regexp. Here are some silly examples:
|
|
|
|
$x = "abcdef";
|
|
$x =~ /abc(?{print "Hi Mom!";})def/; # matches,
|
|
# prints 'Hi Mom!'
|
|
$x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
|
|
# no 'Hi Mom!'
|
|
|
|
Pay careful attention to the next example:
|
|
|
|
$x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
|
|
# no 'Hi Mom!'
|
|
# but why not?
|
|
|
|
At first glance, you'd think that it shouldn't print, because obviously
|
|
the C<ddd> isn't going to match the target string. But look at this
|
|
example:
|
|
|
|
$x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
|
|
# but _does_ print
|
|
|
|
Hmm. What happened here? If you've been following along, you know that
|
|
the above pattern should be effectively the same as the last one --
|
|
enclosing the d in a character class isn't going to change what it
|
|
matches. So why does the first not print while the second one does?
|
|
|
|
The answer lies in the optimizations the REx engine makes. In the first
|
|
case, all the engine sees are plain old characters (aside from the
|
|
C<?{}> construct). It's smart enough to realize that the string 'ddd'
|
|
doesn't occur in our target string before actually running the pattern
|
|
through. But in the second case, we've tricked it into thinking that our
|
|
pattern is more complicated than it is. It takes a look, sees our
|
|
character class, and decides that it will have to actually run the
|
|
pattern to determine whether or not it matches, and in the process of
|
|
running it hits the print statement before it discovers that we don't
|
|
have a match.
|
|
|
|
To take a closer look at how the engine does optimizations, see the
|
|
section L<"Pragmas and debugging"> below.
|
|
|
|
More fun with C<?{}>:
|
|
|
|
$x =~ /(?{print "Hi Mom!";})/; # matches,
|
|
# prints 'Hi Mom!'
|
|
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
|
|
# prints '1'
|
|
$x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
|
|
# prints '1'
|
|
|
|
The bit of magic mentioned in the section title occurs when the regexp
|
|
backtracks in the process of searching for a match. If the regexp
|
|
backtracks over a code expression and if the variables used within are
|
|
localized using C<local>, the changes in the variables produced by the
|
|
code expression are undone! Thus, if we wanted to count how many times
|
|
a character got matched inside a group, we could use, e.g.,
|
|
|
|
$x = "aaaa";
|
|
$count = 0; # initialize 'a' count
|
|
$c = "bob"; # test if $c gets clobbered
|
|
$x =~ /(?{local $c = 0;}) # initialize count
|
|
( a # match 'a'
|
|
(?{local $c = $c + 1;}) # increment count
|
|
)* # do this any number of times,
|
|
aa # but match 'aa' at the end
|
|
(?{$count = $c;}) # copy local $c var into $count
|
|
/x;
|
|
print "'a' count is $count, \$c variable is '$c'\n";
|
|
|
|
This prints
|
|
|
|
'a' count is 2, $c variable is 'bob'
|
|
|
|
If we replace the S<C< (?{local $c = $c + 1;})> > with
|
|
S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
|
|
during backtracking, and we get
|
|
|
|
'a' count is 4, $c variable is 'bob'
|
|
|
|
Note that only localized variable changes are undone. Other side
|
|
effects of code expression execution are permanent. Thus
|
|
|
|
$x = "aaaa";
|
|
$x =~ /(a(?{print "Yow\n";}))*aa/;
|
|
|
|
produces
|
|
|
|
Yow
|
|
Yow
|
|
Yow
|
|
Yow
|
|
|
|
The result C<$^R> is automatically localized, so that it will behave
|
|
properly in the presence of backtracking.
|
|
|
|
This example uses a code expression in a conditional to match the
|
|
article 'the' in either English or German:
|
|
|
|
$lang = 'DE'; # use German
|
|
...
|
|
$text = "das";
|
|
print "matched\n"
|
|
if $text =~ /(?(?{
|
|
$lang eq 'EN'; # is the language English?
|
|
})
|
|
the | # if so, then match 'the'
|
|
(die|das|der) # else, match 'die|das|der'
|
|
)
|
|
/xi;
|
|
|
|
Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
|
|
C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
|
|
code expression, we don't need the extra parentheses around the
|
|
conditional.
|
|
|
|
If you try to use code expressions with interpolating variables, perl
|
|
may surprise you:
|
|
|
|
$bar = 5;
|
|
$pat = '(?{ 1 })';
|
|
/foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
|
|
/foo(?{ 1 })$bar/; # compile error!
|
|
/foo${pat}bar/; # compile error!
|
|
|
|
$pat = qr/(?{ $foo = 1 })/; # precompile code regexp
|
|
/foo${pat}bar/; # compiles ok
|
|
|
|
If a regexp has (1) code expressions and interpolating variables,or
|
|
(2) a variable that interpolates a code expression, perl treats the
|
|
regexp as an error. If the code expression is precompiled into a
|
|
variable, however, interpolating is ok. The question is, why is this
|
|
an error?
|
|
|
|
The reason is that variable interpolation and code expressions
|
|
together pose a security risk. The combination is dangerous because
|
|
many programmers who write search engines often take user input and
|
|
plug it directly into a regexp:
|
|
|
|
$regexp = <>; # read user-supplied regexp
|
|
$chomp $regexp; # get rid of possible newline
|
|
$text =~ /$regexp/; # search $text for the $regexp
|
|
|
|
If the C<$regexp> variable contains a code expression, the user could
|
|
then execute arbitrary Perl code. For instance, some joker could
|
|
search for S<C<system('rm -rf *');> > to erase your files. In this
|
|
sense, the combination of interpolation and code expressions B<taints>
|
|
your regexp. So by default, using both interpolation and code
|
|
expressions in the same regexp is not allowed. If you're not
|
|
concerned about malicious users, it is possible to bypass this
|
|
security check by invoking S<C<use re 'eval'> >:
|
|
|
|
use re 'eval'; # throw caution out the door
|
|
$bar = 5;
|
|
$pat = '(?{ 1 })';
|
|
/foo(?{ 1 })$bar/; # compiles ok
|
|
/foo${pat}bar/; # compiles ok
|
|
|
|
Another form of code expression is the S<B<pattern code expression> >.
|
|
The pattern code expression is like a regular code expression, except
|
|
that the result of the code evaluation is treated as a regular
|
|
expression and matched immediately. A simple example is
|
|
|
|
$length = 5;
|
|
$char = 'a';
|
|
$x = 'aaaaabb';
|
|
$x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
|
|
|
|
|
|
This final example contains both ordinary and pattern code
|
|
expressions. It detects if a binary string C<1101010010001...> has a
|
|
Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
|
|
|
|
$s0 = 0; $s1 = 1; # initial conditions
|
|
$x = "1101010010001000001";
|
|
print "It is a Fibonacci sequence\n"
|
|
if $x =~ /^1 # match an initial '1'
|
|
(
|
|
(??{'0' x $s0}) # match $s0 of '0'
|
|
1 # and then a '1'
|
|
(?{
|
|
$largest = $s0; # largest seq so far
|
|
$s2 = $s1 + $s0; # compute next term
|
|
$s0 = $s1; # in Fibonacci sequence
|
|
$s1 = $s2;
|
|
})
|
|
)+ # repeat as needed
|
|
$ # that is all there is
|
|
/x;
|
|
print "Largest sequence matched was $largest\n";
|
|
|
|
This prints
|
|
|
|
It is a Fibonacci sequence
|
|
Largest sequence matched was 5
|
|
|
|
Ha! Try that with your garden variety regexp package...
|
|
|
|
Note that the variables C<$s0> and C<$s1> are not substituted when the
|
|
regexp is compiled, as happens for ordinary variables outside a code
|
|
expression. Rather, the code expressions are evaluated when perl
|
|
encounters them during the search for a match.
|
|
|
|
The regexp without the C<//x> modifier is
|
|
|
|
/^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
|
|
|
|
and is a great start on an Obfuscated Perl entry :-) When working with
|
|
code and conditional expressions, the extended form of regexps is
|
|
almost necessary in creating and debugging regexps.
|
|
|
|
=head2 Pragmas and debugging
|
|
|
|
Speaking of debugging, there are several pragmas available to control
|
|
and debug regexps in Perl. We have already encountered one pragma in
|
|
the previous section, S<C<use re 'eval';> >, that allows variable
|
|
interpolation and code expressions to coexist in a regexp. The other
|
|
pragmas are
|
|
|
|
use re 'taint';
|
|
$tainted = <>;
|
|
@parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
|
|
|
|
The C<taint> pragma causes any substrings from a match with a tainted
|
|
variable to be tainted as well. This is not normally the case, as
|
|
regexps are often used to extract the safe bits from a tainted
|
|
variable. Use C<taint> when you are not extracting safe bits, but are
|
|
performing some other processing. Both C<taint> and C<eval> pragmas
|
|
are lexically scoped, which means they are in effect only until
|
|
the end of the block enclosing the pragmas.
|
|
|
|
use re 'debug';
|
|
/^(.*)$/s; # output debugging info
|
|
|
|
use re 'debugcolor';
|
|
/^(.*)$/s; # output debugging info in living color
|
|
|
|
The global C<debug> and C<debugcolor> pragmas allow one to get
|
|
detailed debugging info about regexp compilation and
|
|
execution. C<debugcolor> is the same as debug, except the debugging
|
|
information is displayed in color on terminals that can display
|
|
termcap color sequences. Here is example output:
|
|
|
|
% perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
|
|
Compiling REx `a*b+c'
|
|
size 9 first at 1
|
|
1: STAR(4)
|
|
2: EXACT <a>(0)
|
|
4: PLUS(7)
|
|
5: EXACT <b>(0)
|
|
7: EXACT <c>(9)
|
|
9: END(0)
|
|
floating `bc' at 0..2147483647 (checking floating) minlen 2
|
|
Guessing start of match, REx `a*b+c' against `abc'...
|
|
Found floating substr `bc' at offset 1...
|
|
Guessed: match at offset 0
|
|
Matching REx `a*b+c' against `abc'
|
|
Setting an EVAL scope, savestack=3
|
|
0 <> <abc> | 1: STAR
|
|
EXACT <a> can match 1 times out of 32767...
|
|
Setting an EVAL scope, savestack=3
|
|
1 <a> <bc> | 4: PLUS
|
|
EXACT <b> can match 1 times out of 32767...
|
|
Setting an EVAL scope, savestack=3
|
|
2 <ab> <c> | 7: EXACT <c>
|
|
3 <abc> <> | 9: END
|
|
Match successful!
|
|
Freeing REx: `a*b+c'
|
|
|
|
If you have gotten this far into the tutorial, you can probably guess
|
|
what the different parts of the debugging output tell you. The first
|
|
part
|
|
|
|
Compiling REx `a*b+c'
|
|
size 9 first at 1
|
|
1: STAR(4)
|
|
2: EXACT <a>(0)
|
|
4: PLUS(7)
|
|
5: EXACT <b>(0)
|
|
7: EXACT <c>(9)
|
|
9: END(0)
|
|
|
|
describes the compilation stage. C<STAR(4)> means that there is a
|
|
starred object, in this case C<'a'>, and if it matches, goto line 4,
|
|
i.e., C<PLUS(7)>. The middle lines describe some heuristics and
|
|
optimizations performed before a match:
|
|
|
|
floating `bc' at 0..2147483647 (checking floating) minlen 2
|
|
Guessing start of match, REx `a*b+c' against `abc'...
|
|
Found floating substr `bc' at offset 1...
|
|
Guessed: match at offset 0
|
|
|
|
Then the match is executed and the remaining lines describe the
|
|
process:
|
|
|
|
Matching REx `a*b+c' against `abc'
|
|
Setting an EVAL scope, savestack=3
|
|
0 <> <abc> | 1: STAR
|
|
EXACT <a> can match 1 times out of 32767...
|
|
Setting an EVAL scope, savestack=3
|
|
1 <a> <bc> | 4: PLUS
|
|
EXACT <b> can match 1 times out of 32767...
|
|
Setting an EVAL scope, savestack=3
|
|
2 <ab> <c> | 7: EXACT <c>
|
|
3 <abc> <> | 9: END
|
|
Match successful!
|
|
Freeing REx: `a*b+c'
|
|
|
|
Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
|
|
part of the string matched and C<< <y> >> the part not yet
|
|
matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
|
|
n the compilation list above. See
|
|
L<perldebguts/"Debugging regular expressions"> for much more detail.
|
|
|
|
An alternative method of debugging regexps is to embed C<print>
|
|
statements within the regexp. This provides a blow-by-blow account of
|
|
the backtracking in an alternation:
|
|
|
|
"that this" =~ m@(?{print "Start at position ", pos, "\n";})
|
|
t(?{print "t1\n";})
|
|
h(?{print "h1\n";})
|
|
i(?{print "i1\n";})
|
|
s(?{print "s1\n";})
|
|
|
|
|
t(?{print "t2\n";})
|
|
h(?{print "h2\n";})
|
|
a(?{print "a2\n";})
|
|
t(?{print "t2\n";})
|
|
(?{print "Done at position ", pos, "\n";})
|
|
@x;
|
|
|
|
prints
|
|
|
|
Start at position 0
|
|
t1
|
|
h1
|
|
t2
|
|
h2
|
|
a2
|
|
t2
|
|
Done at position 4
|
|
|
|
=head1 BUGS
|
|
|
|
Code expressions, conditional expressions, and independent expressions
|
|
are B<experimental>. Don't use them in production code. Yet.
|
|
|
|
=head1 SEE ALSO
|
|
|
|
This is just a tutorial. For the full story on perl regular
|
|
expressions, see the L<perlre> regular expressions reference page.
|
|
|
|
For more information on the matching C<m//> and substitution C<s///>
|
|
operators, see L<perlop/"Regexp Quote-Like Operators">. For
|
|
information on the C<split> operation, see L<perlfunc/split>.
|
|
|
|
For an excellent all-around resource on the care and feeding of
|
|
regular expressions, see the book I<Mastering Regular Expressions> by
|
|
Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
|
|
|
|
=head1 AUTHOR AND COPYRIGHT
|
|
|
|
Copyright (c) 2000 Mark Kvale
|
|
All rights reserved.
|
|
|
|
This document may be distributed under the same terms as Perl itself.
|
|
|
|
=head2 Acknowledgments
|
|
|
|
The inspiration for the stop codon DNA example came from the ZIP
|
|
code example in chapter 7 of I<Mastering Regular Expressions>.
|
|
|
|
The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
|
|
Haworth, Ronald J Kimball, and Joe Smith for all their helpful
|
|
comments.
|
|
|
|
=cut
|
|
|